ID: 1188723550

View in Genome Browser
Species Human (GRCh38)
Location X:33552027-33552049
Sequence ACTCTTCAAAGCCTGTAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188723547_1188723550 -9 Left 1188723547 X:33552013-33552035 CCCAGTTGGTTTGGACTCTTCAA No data
Right 1188723550 X:33552027-33552049 ACTCTTCAAAGCCTGTAGGCTGG No data
1188723548_1188723550 -10 Left 1188723548 X:33552014-33552036 CCAGTTGGTTTGGACTCTTCAAA No data
Right 1188723550 X:33552027-33552049 ACTCTTCAAAGCCTGTAGGCTGG No data
1188723546_1188723550 -4 Left 1188723546 X:33552008-33552030 CCATTCCCAGTTGGTTTGGACTC No data
Right 1188723550 X:33552027-33552049 ACTCTTCAAAGCCTGTAGGCTGG No data
1188723541_1188723550 29 Left 1188723541 X:33551975-33551997 CCAGAGAAGCTCTGCTGTGCTAA No data
Right 1188723550 X:33552027-33552049 ACTCTTCAAAGCCTGTAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188723550 Original CRISPR ACTCTTCAAAGCCTGTAGGC TGG Intergenic
No off target data available for this crispr