ID: 1188723551

View in Genome Browser
Species Human (GRCh38)
Location X:33552028-33552050
Sequence CTCTTCAAAGCCTGTAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188723548_1188723551 -9 Left 1188723548 X:33552014-33552036 CCAGTTGGTTTGGACTCTTCAAA No data
Right 1188723551 X:33552028-33552050 CTCTTCAAAGCCTGTAGGCTGGG No data
1188723541_1188723551 30 Left 1188723541 X:33551975-33551997 CCAGAGAAGCTCTGCTGTGCTAA No data
Right 1188723551 X:33552028-33552050 CTCTTCAAAGCCTGTAGGCTGGG No data
1188723546_1188723551 -3 Left 1188723546 X:33552008-33552030 CCATTCCCAGTTGGTTTGGACTC No data
Right 1188723551 X:33552028-33552050 CTCTTCAAAGCCTGTAGGCTGGG No data
1188723547_1188723551 -8 Left 1188723547 X:33552013-33552035 CCCAGTTGGTTTGGACTCTTCAA No data
Right 1188723551 X:33552028-33552050 CTCTTCAAAGCCTGTAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188723551 Original CRISPR CTCTTCAAAGCCTGTAGGCT GGG Intergenic
No off target data available for this crispr