ID: 1188741656

View in Genome Browser
Species Human (GRCh38)
Location X:33790760-33790782
Sequence CTCCTGTCCCAGGGAAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188741648_1188741656 -8 Left 1188741648 X:33790745-33790767 CCCAAACCAACTCCCCTCCTGTC No data
Right 1188741656 X:33790760-33790782 CTCCTGTCCCAGGGAAAAACTGG No data
1188741649_1188741656 -9 Left 1188741649 X:33790746-33790768 CCAAACCAACTCCCCTCCTGTCC No data
Right 1188741656 X:33790760-33790782 CTCCTGTCCCAGGGAAAAACTGG No data
1188741647_1188741656 -7 Left 1188741647 X:33790744-33790766 CCCCAAACCAACTCCCCTCCTGT No data
Right 1188741656 X:33790760-33790782 CTCCTGTCCCAGGGAAAAACTGG No data
1188741646_1188741656 19 Left 1188741646 X:33790718-33790740 CCTGATATGAGGTGGAACAATTT No data
Right 1188741656 X:33790760-33790782 CTCCTGTCCCAGGGAAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188741656 Original CRISPR CTCCTGTCCCAGGGAAAAAC TGG Intergenic
No off target data available for this crispr