ID: 1188745021

View in Genome Browser
Species Human (GRCh38)
Location X:33830736-33830758
Sequence ATTTGTTAAGGGCCGTCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188745014_1188745021 29 Left 1188745014 X:33830684-33830706 CCAGCTATGGGATGCTGGAACTG No data
Right 1188745021 X:33830736-33830758 ATTTGTTAAGGGCCGTCCTTGGG No data
1188745013_1188745021 30 Left 1188745013 X:33830683-33830705 CCCAGCTATGGGATGCTGGAACT No data
Right 1188745021 X:33830736-33830758 ATTTGTTAAGGGCCGTCCTTGGG No data
1188745015_1188745021 -5 Left 1188745015 X:33830718-33830740 CCTGCACACCAACCAGTCATTTG No data
Right 1188745021 X:33830736-33830758 ATTTGTTAAGGGCCGTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188745021 Original CRISPR ATTTGTTAAGGGCCGTCCTT GGG Intergenic
No off target data available for this crispr