ID: 1188747376

View in Genome Browser
Species Human (GRCh38)
Location X:33862751-33862773
Sequence GGGTGGGTGTGGAGGGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188747376_1188747386 -2 Left 1188747376 X:33862751-33862773 CCACCTCCCCTCCACACCCACCC No data
Right 1188747386 X:33862772-33862794 CCACTATCCTTCCTAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188747376 Original CRISPR GGGTGGGTGTGGAGGGGAGG TGG (reversed) Intergenic
No off target data available for this crispr