ID: 1188749163

View in Genome Browser
Species Human (GRCh38)
Location X:33884559-33884581
Sequence CAAAATGCTGATGGTTATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188749159_1188749163 4 Left 1188749159 X:33884532-33884554 CCTAGAGACTTGTTGAATATCTT 0: 4
1: 114
2: 1747
3: 1983
4: 1545
Right 1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188749163 Original CRISPR CAAAATGCTGATGGTTATAT GGG Intergenic
No off target data available for this crispr