ID: 1188761778

View in Genome Browser
Species Human (GRCh38)
Location X:34041356-34041378
Sequence GACTCACAGCTCCACAGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188761778_1188761782 16 Left 1188761778 X:34041356-34041378 CCAGTCCTGTGGAGCTGTGAGTC No data
Right 1188761782 X:34041395-34041417 TTTGTAAATTATCCATTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188761778 Original CRISPR GACTCACAGCTCCACAGGAC TGG (reversed) Intergenic
No off target data available for this crispr