ID: 1188761782

View in Genome Browser
Species Human (GRCh38)
Location X:34041395-34041417
Sequence TTTGTAAATTATCCATTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188761774_1188761782 27 Left 1188761774 X:34041345-34041367 CCTGAGGCCTCCCAGTCCTGTGG No data
Right 1188761782 X:34041395-34041417 TTTGTAAATTATCCATTCTCAGG No data
1188761777_1188761782 17 Left 1188761777 X:34041355-34041377 CCCAGTCCTGTGGAGCTGTGAGT No data
Right 1188761782 X:34041395-34041417 TTTGTAAATTATCCATTCTCAGG No data
1188761776_1188761782 20 Left 1188761776 X:34041352-34041374 CCTCCCAGTCCTGTGGAGCTGTG No data
Right 1188761782 X:34041395-34041417 TTTGTAAATTATCCATTCTCAGG No data
1188761778_1188761782 16 Left 1188761778 X:34041356-34041378 CCAGTCCTGTGGAGCTGTGAGTC No data
Right 1188761782 X:34041395-34041417 TTTGTAAATTATCCATTCTCAGG No data
1188761779_1188761782 11 Left 1188761779 X:34041361-34041383 CCTGTGGAGCTGTGAGTCAATTA No data
Right 1188761782 X:34041395-34041417 TTTGTAAATTATCCATTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188761782 Original CRISPR TTTGTAAATTATCCATTCTC AGG Intergenic
No off target data available for this crispr