ID: 1188764144

View in Genome Browser
Species Human (GRCh38)
Location X:34070464-34070486
Sequence GGGCACACCAAGTTTATGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188764140_1188764144 0 Left 1188764140 X:34070441-34070463 CCATTTAAATGAAAGTAAGAAAT No data
Right 1188764144 X:34070464-34070486 GGGCACACCAAGTTTATGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188764144 Original CRISPR GGGCACACCAAGTTTATGAT GGG Intergenic
No off target data available for this crispr