ID: 1188779820

View in Genome Browser
Species Human (GRCh38)
Location X:34268101-34268123
Sequence TCTGCCTCACAGAACAAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188779820_1188779823 -6 Left 1188779820 X:34268101-34268123 CCTACCTTGTTCTGTGAGGCAGA No data
Right 1188779823 X:34268118-34268140 GGCAGAGAGCTGGAAATAGTTGG No data
1188779820_1188779824 1 Left 1188779820 X:34268101-34268123 CCTACCTTGTTCTGTGAGGCAGA No data
Right 1188779824 X:34268125-34268147 AGCTGGAAATAGTTGGCAAATGG No data
1188779820_1188779825 10 Left 1188779820 X:34268101-34268123 CCTACCTTGTTCTGTGAGGCAGA No data
Right 1188779825 X:34268134-34268156 TAGTTGGCAAATGGCATTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188779820 Original CRISPR TCTGCCTCACAGAACAAGGT AGG (reversed) Intergenic
No off target data available for this crispr