ID: 1188796821

View in Genome Browser
Species Human (GRCh38)
Location X:34477235-34477257
Sequence CTTACAAATACAGCTAGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188796821_1188796824 9 Left 1188796821 X:34477235-34477257 CCATTGCTAGCTGTATTTGTAAG No data
Right 1188796824 X:34477267-34477289 TTTTTAAGGCAATTGTGAATGGG No data
1188796821_1188796825 27 Left 1188796821 X:34477235-34477257 CCATTGCTAGCTGTATTTGTAAG No data
Right 1188796825 X:34477285-34477307 ATGGGATTTCATTCTTGATTTGG No data
1188796821_1188796823 8 Left 1188796821 X:34477235-34477257 CCATTGCTAGCTGTATTTGTAAG No data
Right 1188796823 X:34477266-34477288 TTTTTTAAGGCAATTGTGAATGG No data
1188796821_1188796822 -5 Left 1188796821 X:34477235-34477257 CCATTGCTAGCTGTATTTGTAAG No data
Right 1188796822 X:34477253-34477275 GTAAGTATTTTATTTTTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188796821 Original CRISPR CTTACAAATACAGCTAGCAA TGG (reversed) Intergenic
No off target data available for this crispr