ID: 1188796823

View in Genome Browser
Species Human (GRCh38)
Location X:34477266-34477288
Sequence TTTTTTAAGGCAATTGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188796821_1188796823 8 Left 1188796821 X:34477235-34477257 CCATTGCTAGCTGTATTTGTAAG No data
Right 1188796823 X:34477266-34477288 TTTTTTAAGGCAATTGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188796823 Original CRISPR TTTTTTAAGGCAATTGTGAA TGG Intergenic
No off target data available for this crispr