ID: 1188796837

View in Genome Browser
Species Human (GRCh38)
Location X:34477546-34477568
Sequence TTGAATAAGAATGATGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188796836_1188796837 8 Left 1188796836 X:34477515-34477537 CCTGATTGCTCTGGACAGAACTT 0: 5
1: 298
2: 7491
3: 9048
4: 4914
Right 1188796837 X:34477546-34477568 TTGAATAAGAATGATGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188796837 Original CRISPR TTGAATAAGAATGATGAGAA AGG Intergenic
No off target data available for this crispr