ID: 1188800565

View in Genome Browser
Species Human (GRCh38)
Location X:34524738-34524760
Sequence TCTTATCTTGAGCAGGTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188800565_1188800569 20 Left 1188800565 X:34524738-34524760 CCTTTTACCTGCTCAAGATAAGA No data
Right 1188800569 X:34524781-34524803 AAGAGATCCTCATTACAGAGAGG No data
1188800565_1188800568 -5 Left 1188800565 X:34524738-34524760 CCTTTTACCTGCTCAAGATAAGA No data
Right 1188800568 X:34524756-34524778 TAAGACTCTAATCTGATTGTGGG No data
1188800565_1188800567 -6 Left 1188800565 X:34524738-34524760 CCTTTTACCTGCTCAAGATAAGA No data
Right 1188800567 X:34524755-34524777 ATAAGACTCTAATCTGATTGTGG No data
1188800565_1188800570 21 Left 1188800565 X:34524738-34524760 CCTTTTACCTGCTCAAGATAAGA No data
Right 1188800570 X:34524782-34524804 AGAGATCCTCATTACAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188800565 Original CRISPR TCTTATCTTGAGCAGGTAAA AGG (reversed) Intergenic
No off target data available for this crispr