ID: 1188803077

View in Genome Browser
Species Human (GRCh38)
Location X:34555539-34555561
Sequence ATGCCTTTCTAGAAAAGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188803077_1188803079 2 Left 1188803077 X:34555539-34555561 CCTTGACTTTTCTAGAAAGGCAT No data
Right 1188803079 X:34555564-34555586 TTTGTGTGGTCCTTTTTCCATGG No data
1188803077_1188803082 18 Left 1188803077 X:34555539-34555561 CCTTGACTTTTCTAGAAAGGCAT No data
Right 1188803082 X:34555580-34555602 TCCATGGTTTGGAGTAAAAGAGG No data
1188803077_1188803080 7 Left 1188803077 X:34555539-34555561 CCTTGACTTTTCTAGAAAGGCAT No data
Right 1188803080 X:34555569-34555591 GTGGTCCTTTTTCCATGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188803077 Original CRISPR ATGCCTTTCTAGAAAAGTCA AGG (reversed) Intergenic
No off target data available for this crispr