ID: 1188806728

View in Genome Browser
Species Human (GRCh38)
Location X:34600011-34600033
Sequence TGTCTAATGCTGTCAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188806723_1188806728 13 Left 1188806723 X:34599975-34599997 CCTGAATACCTTGGTTAATTTTC No data
Right 1188806728 X:34600011-34600033 TGTCTAATGCTGTCAGTGGAGGG No data
1188806724_1188806728 5 Left 1188806724 X:34599983-34600005 CCTTGGTTAATTTTCTGCCTCAA No data
Right 1188806728 X:34600011-34600033 TGTCTAATGCTGTCAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188806728 Original CRISPR TGTCTAATGCTGTCAGTGGA GGG Intergenic
No off target data available for this crispr