ID: 1188808487

View in Genome Browser
Species Human (GRCh38)
Location X:34621634-34621656
Sequence AAGTGGCACTAGAGTGAAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188808479_1188808487 19 Left 1188808479 X:34621592-34621614 CCACAAGTTTGGTTCTACCTGGG No data
Right 1188808487 X:34621634-34621656 AAGTGGCACTAGAGTGAAGGCGG No data
1188808481_1188808487 2 Left 1188808481 X:34621609-34621631 CCTGGGCTTGATTCACCTGAGCC No data
Right 1188808487 X:34621634-34621656 AAGTGGCACTAGAGTGAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188808487 Original CRISPR AAGTGGCACTAGAGTGAAGG CGG Intergenic
No off target data available for this crispr