ID: 1188816004

View in Genome Browser
Species Human (GRCh38)
Location X:34715091-34715113
Sequence TAAGCTCCAGACATTGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188816003_1188816004 6 Left 1188816003 X:34715062-34715084 CCATGGCTACAAGTATAACTTCT No data
Right 1188816004 X:34715091-34715113 TAAGCTCCAGACATTGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188816004 Original CRISPR TAAGCTCCAGACATTGATAT TGG Intergenic
No off target data available for this crispr