ID: 1188816566

View in Genome Browser
Species Human (GRCh38)
Location X:34722245-34722267
Sequence CAGAATGAGCTTGATGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188816559_1188816566 -5 Left 1188816559 X:34722227-34722249 CCTAGTAGAACTACCACCCAGAA No data
Right 1188816566 X:34722245-34722267 CAGAATGAGCTTGATGGGGAAGG No data
1188816558_1188816566 -1 Left 1188816558 X:34722223-34722245 CCATCCTAGTAGAACTACCACCC No data
Right 1188816566 X:34722245-34722267 CAGAATGAGCTTGATGGGGAAGG No data
1188816557_1188816566 19 Left 1188816557 X:34722203-34722225 CCTGATTGTGATGACTTGCTCCA No data
Right 1188816566 X:34722245-34722267 CAGAATGAGCTTGATGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188816566 Original CRISPR CAGAATGAGCTTGATGGGGA AGG Intergenic
No off target data available for this crispr