ID: 1188819645

View in Genome Browser
Species Human (GRCh38)
Location X:34758934-34758956
Sequence CAACCAATTAACTTTAGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188819639_1188819645 29 Left 1188819639 X:34758882-34758904 CCAGTCCCTTTTGGCCTGGAACT No data
Right 1188819645 X:34758934-34758956 CAACCAATTAACTTTAGAAGAGG No data
1188819641_1188819645 23 Left 1188819641 X:34758888-34758910 CCTTTTGGCCTGGAACTTCAAAC No data
Right 1188819645 X:34758934-34758956 CAACCAATTAACTTTAGAAGAGG No data
1188819642_1188819645 15 Left 1188819642 X:34758896-34758918 CCTGGAACTTCAAACTTGCAAAA No data
Right 1188819645 X:34758934-34758956 CAACCAATTAACTTTAGAAGAGG No data
1188819640_1188819645 24 Left 1188819640 X:34758887-34758909 CCCTTTTGGCCTGGAACTTCAAA No data
Right 1188819645 X:34758934-34758956 CAACCAATTAACTTTAGAAGAGG No data
1188819638_1188819645 30 Left 1188819638 X:34758881-34758903 CCCAGTCCCTTTTGGCCTGGAAC No data
Right 1188819645 X:34758934-34758956 CAACCAATTAACTTTAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188819645 Original CRISPR CAACCAATTAACTTTAGAAG AGG Intergenic
No off target data available for this crispr