ID: 1188820331

View in Genome Browser
Species Human (GRCh38)
Location X:34767192-34767214
Sequence TAAAACTAAGCTGGGTGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188820331_1188820335 28 Left 1188820331 X:34767192-34767214 CCACTGCACCCAGCTTAGTTTTA No data
Right 1188820335 X:34767243-34767265 GATGTAATCAAACATATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188820331 Original CRISPR TAAAACTAAGCTGGGTGCAG TGG (reversed) Intergenic
No off target data available for this crispr