ID: 1188820333

View in Genome Browser
Species Human (GRCh38)
Location X:34767200-34767222
Sequence TCCAAAAATAAAACTAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188820333_1188820335 20 Left 1188820333 X:34767200-34767222 CCCAGCTTAGTTTTATTTTTGGA No data
Right 1188820335 X:34767243-34767265 GATGTAATCAAACATATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188820333 Original CRISPR TCCAAAAATAAAACTAAGCT GGG (reversed) Intergenic