ID: 1188820334

View in Genome Browser
Species Human (GRCh38)
Location X:34767201-34767223
Sequence TTCCAAAAATAAAACTAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188820334_1188820335 19 Left 1188820334 X:34767201-34767223 CCAGCTTAGTTTTATTTTTGGAA No data
Right 1188820335 X:34767243-34767265 GATGTAATCAAACATATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188820334 Original CRISPR TTCCAAAAATAAAACTAAGC TGG (reversed) Intergenic
No off target data available for this crispr