ID: 1188820335

View in Genome Browser
Species Human (GRCh38)
Location X:34767243-34767265
Sequence GATGTAATCAAACATATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188820333_1188820335 20 Left 1188820333 X:34767200-34767222 CCCAGCTTAGTTTTATTTTTGGA No data
Right 1188820335 X:34767243-34767265 GATGTAATCAAACATATTTCAGG No data
1188820331_1188820335 28 Left 1188820331 X:34767192-34767214 CCACTGCACCCAGCTTAGTTTTA No data
Right 1188820335 X:34767243-34767265 GATGTAATCAAACATATTTCAGG No data
1188820334_1188820335 19 Left 1188820334 X:34767201-34767223 CCAGCTTAGTTTTATTTTTGGAA No data
Right 1188820335 X:34767243-34767265 GATGTAATCAAACATATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188820335 Original CRISPR GATGTAATCAAACATATTTC AGG Intergenic
No off target data available for this crispr