ID: 1188827607

View in Genome Browser
Species Human (GRCh38)
Location X:34855538-34855560
Sequence GGCTCTGCCTCCCAAATAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188827600_1188827607 16 Left 1188827600 X:34855499-34855521 CCTTGAAGCCTCGAACTTCTGGG No data
Right 1188827607 X:34855538-34855560 GGCTCTGCCTCCCAAATAGGTGG No data
1188827602_1188827607 8 Left 1188827602 X:34855507-34855529 CCTCGAACTTCTGGGATCAATCA No data
Right 1188827607 X:34855538-34855560 GGCTCTGCCTCCCAAATAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188827607 Original CRISPR GGCTCTGCCTCCCAAATAGG TGG Intergenic
No off target data available for this crispr