ID: 1188844629

View in Genome Browser
Species Human (GRCh38)
Location X:35058209-35058231
Sequence CTCCCTCTGCTGACTTGACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188844629_1188844633 -1 Left 1188844629 X:35058209-35058231 CCGTGTCAAGTCAGCAGAGGGAG No data
Right 1188844633 X:35058231-35058253 GGCATCCTAGCCCCTTTAAGGGG No data
1188844629_1188844632 -2 Left 1188844629 X:35058209-35058231 CCGTGTCAAGTCAGCAGAGGGAG No data
Right 1188844632 X:35058230-35058252 AGGCATCCTAGCCCCTTTAAGGG No data
1188844629_1188844631 -3 Left 1188844629 X:35058209-35058231 CCGTGTCAAGTCAGCAGAGGGAG No data
Right 1188844631 X:35058229-35058251 GAGGCATCCTAGCCCCTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188844629 Original CRISPR CTCCCTCTGCTGACTTGACA CGG (reversed) Intergenic
No off target data available for this crispr