ID: 1188844631

View in Genome Browser
Species Human (GRCh38)
Location X:35058229-35058251
Sequence GAGGCATCCTAGCCCCTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188844629_1188844631 -3 Left 1188844629 X:35058209-35058231 CCGTGTCAAGTCAGCAGAGGGAG No data
Right 1188844631 X:35058229-35058251 GAGGCATCCTAGCCCCTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188844631 Original CRISPR GAGGCATCCTAGCCCCTTTA AGG Intergenic
No off target data available for this crispr