ID: 1188844668

View in Genome Browser
Species Human (GRCh38)
Location X:35058476-35058498
Sequence CCTGAGATATTTAAGGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188844668_1188844676 27 Left 1188844668 X:35058476-35058498 CCATCTACCTTAAATATCTCAGG No data
Right 1188844676 X:35058526-35058548 AGCTCTTGGGTCAGTAGAGGTGG No data
1188844668_1188844677 28 Left 1188844668 X:35058476-35058498 CCATCTACCTTAAATATCTCAGG No data
Right 1188844677 X:35058527-35058549 GCTCTTGGGTCAGTAGAGGTGGG No data
1188844668_1188844673 13 Left 1188844668 X:35058476-35058498 CCATCTACCTTAAATATCTCAGG No data
Right 1188844673 X:35058512-35058534 CTTTCTGAGGTGATAGCTCTTGG No data
1188844668_1188844675 24 Left 1188844668 X:35058476-35058498 CCATCTACCTTAAATATCTCAGG No data
Right 1188844675 X:35058523-35058545 GATAGCTCTTGGGTCAGTAGAGG No data
1188844668_1188844672 0 Left 1188844668 X:35058476-35058498 CCATCTACCTTAAATATCTCAGG No data
Right 1188844672 X:35058499-35058521 GAAATTAAGAGCTCTTTCTGAGG No data
1188844668_1188844674 14 Left 1188844668 X:35058476-35058498 CCATCTACCTTAAATATCTCAGG No data
Right 1188844674 X:35058513-35058535 TTTCTGAGGTGATAGCTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188844668 Original CRISPR CCTGAGATATTTAAGGTAGA TGG (reversed) Intergenic
No off target data available for this crispr