ID: 1188845303

View in Genome Browser
Species Human (GRCh38)
Location X:35065096-35065118
Sequence TGTAGCAAGCAGTCTAAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188845303_1188845305 5 Left 1188845303 X:35065096-35065118 CCTACCTTAGACTGCTTGCTACA No data
Right 1188845305 X:35065124-35065146 TCAAGCAGACTGACTATTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188845303 Original CRISPR TGTAGCAAGCAGTCTAAGGT AGG (reversed) Intergenic
No off target data available for this crispr