ID: 1188852034

View in Genome Browser
Species Human (GRCh38)
Location X:35143930-35143952
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188852034_1188852040 5 Left 1188852034 X:35143930-35143952 CCATCCACATGCTTCTTCCCCAG No data
Right 1188852040 X:35143958-35143980 TTTGTTACTGATCTTCCAACTGG No data
1188852034_1188852042 29 Left 1188852034 X:35143930-35143952 CCATCCACATGCTTCTTCCCCAG No data
Right 1188852042 X:35143982-35144004 CAGTGACTGATCTTAGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188852034 Original CRISPR CTGGGGAAGAAGCATGTGGA TGG (reversed) Intergenic
No off target data available for this crispr