ID: 1188852034 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:35143930-35143952 |
Sequence | CTGGGGAAGAAGCATGTGGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1188852034_1188852042 | 29 | Left | 1188852034 | X:35143930-35143952 | CCATCCACATGCTTCTTCCCCAG | No data | ||
Right | 1188852042 | X:35143982-35144004 | CAGTGACTGATCTTAGTGACTGG | No data | ||||
1188852034_1188852040 | 5 | Left | 1188852034 | X:35143930-35143952 | CCATCCACATGCTTCTTCCCCAG | No data | ||
Right | 1188852040 | X:35143958-35143980 | TTTGTTACTGATCTTCCAACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1188852034 | Original CRISPR | CTGGGGAAGAAGCATGTGGA TGG (reversed) | Intergenic | ||
No off target data available for this crispr |