ID: 1188852036

View in Genome Browser
Species Human (GRCh38)
Location X:35143934-35143956
Sequence AATCCTGGGGAAGAAGCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188852036_1188852043 30 Left 1188852036 X:35143934-35143956 CCACATGCTTCTTCCCCAGGATT No data
Right 1188852043 X:35143987-35144009 ACTGATCTTAGTGACTGGACAGG No data
1188852036_1188852040 1 Left 1188852036 X:35143934-35143956 CCACATGCTTCTTCCCCAGGATT No data
Right 1188852040 X:35143958-35143980 TTTGTTACTGATCTTCCAACTGG No data
1188852036_1188852042 25 Left 1188852036 X:35143934-35143956 CCACATGCTTCTTCCCCAGGATT No data
Right 1188852042 X:35143982-35144004 CAGTGACTGATCTTAGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188852036 Original CRISPR AATCCTGGGGAAGAAGCATG TGG (reversed) Intergenic