ID: 1188852039

View in Genome Browser
Species Human (GRCh38)
Location X:35143949-35143971
Sequence AGATCAGTAACAAAGAATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188852039_1188852043 15 Left 1188852039 X:35143949-35143971 CCAGGATTCTTTGTTACTGATCT No data
Right 1188852043 X:35143987-35144009 ACTGATCTTAGTGACTGGACAGG No data
1188852039_1188852042 10 Left 1188852039 X:35143949-35143971 CCAGGATTCTTTGTTACTGATCT No data
Right 1188852042 X:35143982-35144004 CAGTGACTGATCTTAGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188852039 Original CRISPR AGATCAGTAACAAAGAATCC TGG (reversed) Intergenic