ID: 1188852040

View in Genome Browser
Species Human (GRCh38)
Location X:35143958-35143980
Sequence TTTGTTACTGATCTTCCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188852032_1188852040 19 Left 1188852032 X:35143916-35143938 CCATTCCAATAGGTCCATCCACA No data
Right 1188852040 X:35143958-35143980 TTTGTTACTGATCTTCCAACTGG No data
1188852031_1188852040 20 Left 1188852031 X:35143915-35143937 CCCATTCCAATAGGTCCATCCAC No data
Right 1188852040 X:35143958-35143980 TTTGTTACTGATCTTCCAACTGG No data
1188852036_1188852040 1 Left 1188852036 X:35143934-35143956 CCACATGCTTCTTCCCCAGGATT No data
Right 1188852040 X:35143958-35143980 TTTGTTACTGATCTTCCAACTGG No data
1188852033_1188852040 14 Left 1188852033 X:35143921-35143943 CCAATAGGTCCATCCACATGCTT No data
Right 1188852040 X:35143958-35143980 TTTGTTACTGATCTTCCAACTGG No data
1188852034_1188852040 5 Left 1188852034 X:35143930-35143952 CCATCCACATGCTTCTTCCCCAG No data
Right 1188852040 X:35143958-35143980 TTTGTTACTGATCTTCCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188852040 Original CRISPR TTTGTTACTGATCTTCCAAC TGG Intergenic