ID: 1188852043

View in Genome Browser
Species Human (GRCh38)
Location X:35143987-35144009
Sequence ACTGATCTTAGTGACTGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188852039_1188852043 15 Left 1188852039 X:35143949-35143971 CCAGGATTCTTTGTTACTGATCT No data
Right 1188852043 X:35143987-35144009 ACTGATCTTAGTGACTGGACAGG No data
1188852041_1188852043 -9 Left 1188852041 X:35143973-35143995 CCAACTGGACAGTGACTGATCTT No data
Right 1188852043 X:35143987-35144009 ACTGATCTTAGTGACTGGACAGG No data
1188852036_1188852043 30 Left 1188852036 X:35143934-35143956 CCACATGCTTCTTCCCCAGGATT No data
Right 1188852043 X:35143987-35144009 ACTGATCTTAGTGACTGGACAGG No data
1188852038_1188852043 16 Left 1188852038 X:35143948-35143970 CCCAGGATTCTTTGTTACTGATC No data
Right 1188852043 X:35143987-35144009 ACTGATCTTAGTGACTGGACAGG No data
1188852037_1188852043 17 Left 1188852037 X:35143947-35143969 CCCCAGGATTCTTTGTTACTGAT No data
Right 1188852043 X:35143987-35144009 ACTGATCTTAGTGACTGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188852043 Original CRISPR ACTGATCTTAGTGACTGGAC AGG Intergenic