ID: 1188855016

View in Genome Browser
Species Human (GRCh38)
Location X:35183670-35183692
Sequence TGATCTGTATTAAACTTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188855013_1188855016 11 Left 1188855013 X:35183636-35183658 CCTTCAAAATGGGGCTCTGCCAT No data
Right 1188855016 X:35183670-35183692 TGATCTGTATTAAACTTGACAGG No data
1188855014_1188855016 -8 Left 1188855014 X:35183655-35183677 CCATCTTCAACATCCTGATCTGT No data
Right 1188855016 X:35183670-35183692 TGATCTGTATTAAACTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188855016 Original CRISPR TGATCTGTATTAAACTTGAC AGG Intergenic
No off target data available for this crispr