ID: 1188856490

View in Genome Browser
Species Human (GRCh38)
Location X:35202385-35202407
Sequence TCCAGAACATTCCTGGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188856490_1188856495 24 Left 1188856490 X:35202385-35202407 CCAAATTCCAGGAATGTTCTGGA No data
Right 1188856495 X:35202432-35202454 TAAGAGCTGGCACATTCTGTGGG No data
1188856490_1188856492 11 Left 1188856490 X:35202385-35202407 CCAAATTCCAGGAATGTTCTGGA No data
Right 1188856492 X:35202419-35202441 CTCCTCTCGTATCTAAGAGCTGG No data
1188856490_1188856494 23 Left 1188856490 X:35202385-35202407 CCAAATTCCAGGAATGTTCTGGA No data
Right 1188856494 X:35202431-35202453 CTAAGAGCTGGCACATTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188856490 Original CRISPR TCCAGAACATTCCTGGAATT TGG (reversed) Intergenic
No off target data available for this crispr