ID: 1188861925

View in Genome Browser
Species Human (GRCh38)
Location X:35268687-35268709
Sequence TGCAATGATCTGGATGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188861923_1188861925 -6 Left 1188861923 X:35268670-35268692 CCAAATGTGATGGCATTTGCAAT No data
Right 1188861925 X:35268687-35268709 TGCAATGATCTGGATGAGATTGG No data
1188861922_1188861925 -1 Left 1188861922 X:35268665-35268687 CCAATCCAAATGTGATGGCATTT No data
Right 1188861925 X:35268687-35268709 TGCAATGATCTGGATGAGATTGG No data
1188861920_1188861925 6 Left 1188861920 X:35268658-35268680 CCTGGAACCAATCCAAATGTGAT No data
Right 1188861925 X:35268687-35268709 TGCAATGATCTGGATGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188861925 Original CRISPR TGCAATGATCTGGATGAGAT TGG Intergenic
No off target data available for this crispr