ID: 1188864544

View in Genome Browser
Species Human (GRCh38)
Location X:35299413-35299435
Sequence GGTTCTCTCTCCATGCCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188864544_1188864546 -5 Left 1188864544 X:35299413-35299435 CCTCATGGCATGGAGAGAGAACC No data
Right 1188864546 X:35299431-35299453 GAACCCATGCACTTGAGGAACGG No data
1188864544_1188864550 15 Left 1188864544 X:35299413-35299435 CCTCATGGCATGGAGAGAGAACC No data
Right 1188864550 X:35299451-35299473 CGGAGAGCACAGTGATTGTAGGG No data
1188864544_1188864549 14 Left 1188864544 X:35299413-35299435 CCTCATGGCATGGAGAGAGAACC No data
Right 1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG No data
1188864544_1188864545 -10 Left 1188864544 X:35299413-35299435 CCTCATGGCATGGAGAGAGAACC No data
Right 1188864545 X:35299426-35299448 AGAGAGAACCCATGCACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188864544 Original CRISPR GGTTCTCTCTCCATGCCATG AGG (reversed) Intergenic
No off target data available for this crispr