ID: 1188864546

View in Genome Browser
Species Human (GRCh38)
Location X:35299431-35299453
Sequence GAACCCATGCACTTGAGGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188864538_1188864546 19 Left 1188864538 X:35299389-35299411 CCCTCCTCCATCTTCTGGCAACA No data
Right 1188864546 X:35299431-35299453 GAACCCATGCACTTGAGGAACGG No data
1188864537_1188864546 23 Left 1188864537 X:35299385-35299407 CCAGCCCTCCTCCATCTTCTGGC No data
Right 1188864546 X:35299431-35299453 GAACCCATGCACTTGAGGAACGG No data
1188864541_1188864546 12 Left 1188864541 X:35299396-35299418 CCATCTTCTGGCAACAGCCTCAT No data
Right 1188864546 X:35299431-35299453 GAACCCATGCACTTGAGGAACGG No data
1188864544_1188864546 -5 Left 1188864544 X:35299413-35299435 CCTCATGGCATGGAGAGAGAACC No data
Right 1188864546 X:35299431-35299453 GAACCCATGCACTTGAGGAACGG No data
1188864540_1188864546 15 Left 1188864540 X:35299393-35299415 CCTCCATCTTCTGGCAACAGCCT No data
Right 1188864546 X:35299431-35299453 GAACCCATGCACTTGAGGAACGG No data
1188864539_1188864546 18 Left 1188864539 X:35299390-35299412 CCTCCTCCATCTTCTGGCAACAG No data
Right 1188864546 X:35299431-35299453 GAACCCATGCACTTGAGGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188864546 Original CRISPR GAACCCATGCACTTGAGGAA CGG Intergenic
No off target data available for this crispr