ID: 1188864547

View in Genome Browser
Species Human (GRCh38)
Location X:35299434-35299456
Sequence TCTCCGTTCCTCAAGTGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188864547_1188864549 -7 Left 1188864547 X:35299434-35299456 CCCATGCACTTGAGGAACGGAGA No data
Right 1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG No data
1188864547_1188864551 13 Left 1188864547 X:35299434-35299456 CCCATGCACTTGAGGAACGGAGA No data
Right 1188864551 X:35299470-35299492 AGGGAAATTACCCATCCTAATGG No data
1188864547_1188864550 -6 Left 1188864547 X:35299434-35299456 CCCATGCACTTGAGGAACGGAGA No data
Right 1188864550 X:35299451-35299473 CGGAGAGCACAGTGATTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188864547 Original CRISPR TCTCCGTTCCTCAAGTGCAT GGG (reversed) Intergenic
No off target data available for this crispr