ID: 1188864548

View in Genome Browser
Species Human (GRCh38)
Location X:35299435-35299457
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188864548_1188864549 -8 Left 1188864548 X:35299435-35299457 CCATGCACTTGAGGAACGGAGAG No data
Right 1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG No data
1188864548_1188864550 -7 Left 1188864548 X:35299435-35299457 CCATGCACTTGAGGAACGGAGAG No data
Right 1188864550 X:35299451-35299473 CGGAGAGCACAGTGATTGTAGGG No data
1188864548_1188864551 12 Left 1188864548 X:35299435-35299457 CCATGCACTTGAGGAACGGAGAG No data
Right 1188864551 X:35299470-35299492 AGGGAAATTACCCATCCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188864548 Original CRISPR CTCTCCGTTCCTCAAGTGCA TGG (reversed) Intergenic