ID: 1188864549

View in Genome Browser
Species Human (GRCh38)
Location X:35299450-35299472
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188864544_1188864549 14 Left 1188864544 X:35299413-35299435 CCTCATGGCATGGAGAGAGAACC No data
Right 1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG No data
1188864547_1188864549 -7 Left 1188864547 X:35299434-35299456 CCCATGCACTTGAGGAACGGAGA No data
Right 1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG No data
1188864548_1188864549 -8 Left 1188864548 X:35299435-35299457 CCATGCACTTGAGGAACGGAGAG No data
Right 1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188864549 Original CRISPR ACGGAGAGCACAGTGATTGT AGG Intergenic