ID: 1188864551

View in Genome Browser
Species Human (GRCh38)
Location X:35299470-35299492
Sequence AGGGAAATTACCCATCCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188864548_1188864551 12 Left 1188864548 X:35299435-35299457 CCATGCACTTGAGGAACGGAGAG No data
Right 1188864551 X:35299470-35299492 AGGGAAATTACCCATCCTAATGG No data
1188864547_1188864551 13 Left 1188864547 X:35299434-35299456 CCCATGCACTTGAGGAACGGAGA No data
Right 1188864551 X:35299470-35299492 AGGGAAATTACCCATCCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188864551 Original CRISPR AGGGAAATTACCCATCCTAA TGG Intergenic