ID: 1188865207

View in Genome Browser
Species Human (GRCh38)
Location X:35305674-35305696
Sequence TTTTACAGGTGCATGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188865207_1188865213 21 Left 1188865207 X:35305674-35305696 CCTTGCACCATGCACCTGTAAAA No data
Right 1188865213 X:35305718-35305740 CCCATGAAAGCAGCCTGAAGTGG No data
1188865207_1188865216 23 Left 1188865207 X:35305674-35305696 CCTTGCACCATGCACCTGTAAAA No data
Right 1188865216 X:35305720-35305742 CATGAAAGCAGCCTGAAGTGGGG No data
1188865207_1188865215 22 Left 1188865207 X:35305674-35305696 CCTTGCACCATGCACCTGTAAAA No data
Right 1188865215 X:35305719-35305741 CCATGAAAGCAGCCTGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188865207 Original CRISPR TTTTACAGGTGCATGGTGCA AGG (reversed) Intergenic
No off target data available for this crispr