ID: 1188869244

View in Genome Browser
Species Human (GRCh38)
Location X:35353284-35353306
Sequence CTGGTTAGAAAGCACTGATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188869244_1188869248 18 Left 1188869244 X:35353284-35353306 CCCTATCAGTGCTTTCTAACCAG No data
Right 1188869248 X:35353325-35353347 GAGACATAGAACTCAGAATCTGG No data
1188869244_1188869249 30 Left 1188869244 X:35353284-35353306 CCCTATCAGTGCTTTCTAACCAG No data
Right 1188869249 X:35353337-35353359 TCAGAATCTGGATAGTAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188869244 Original CRISPR CTGGTTAGAAAGCACTGATA GGG (reversed) Intergenic
No off target data available for this crispr