ID: 1188870912

View in Genome Browser
Species Human (GRCh38)
Location X:35370645-35370667
Sequence CAGTGTCCCCACAGGGATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188870912_1188870915 7 Left 1188870912 X:35370645-35370667 CCTTAATCCCTGTGGGGACACTG No data
Right 1188870915 X:35370675-35370697 TTCATTGAAATCATAAGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188870912 Original CRISPR CAGTGTCCCCACAGGGATTA AGG (reversed) Intergenic
No off target data available for this crispr