ID: 1188881779

View in Genome Browser
Species Human (GRCh38)
Location X:35499307-35499329
Sequence TCCCGCTGGCTCGCAAGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188881779_1188881794 26 Left 1188881779 X:35499307-35499329 CCGGCGCTTGCGAGCCAGCGGGA No data
Right 1188881794 X:35499356-35499378 GGCCCCGCACTGGGAGCTGCCGG No data
1188881779_1188881785 -5 Left 1188881779 X:35499307-35499329 CCGGCGCTTGCGAGCCAGCGGGA No data
Right 1188881785 X:35499325-35499347 CGGGAGTTCCCGGTGGGGCGTGG No data
1188881779_1188881787 1 Left 1188881779 X:35499307-35499329 CCGGCGCTTGCGAGCCAGCGGGA No data
Right 1188881787 X:35499331-35499353 TTCCCGGTGGGGCGTGGGCTCGG No data
1188881779_1188881791 5 Left 1188881779 X:35499307-35499329 CCGGCGCTTGCGAGCCAGCGGGA No data
Right 1188881791 X:35499335-35499357 CGGTGGGGCGTGGGCTCGGAGGG No data
1188881779_1188881792 16 Left 1188881779 X:35499307-35499329 CCGGCGCTTGCGAGCCAGCGGGA No data
Right 1188881792 X:35499346-35499368 GGGCTCGGAGGGCCCCGCACTGG No data
1188881779_1188881786 -4 Left 1188881779 X:35499307-35499329 CCGGCGCTTGCGAGCCAGCGGGA No data
Right 1188881786 X:35499326-35499348 GGGAGTTCCCGGTGGGGCGTGGG No data
1188881779_1188881793 17 Left 1188881779 X:35499307-35499329 CCGGCGCTTGCGAGCCAGCGGGA No data
Right 1188881793 X:35499347-35499369 GGCTCGGAGGGCCCCGCACTGGG No data
1188881779_1188881790 4 Left 1188881779 X:35499307-35499329 CCGGCGCTTGCGAGCCAGCGGGA No data
Right 1188881790 X:35499334-35499356 CCGGTGGGGCGTGGGCTCGGAGG No data
1188881779_1188881783 -10 Left 1188881779 X:35499307-35499329 CCGGCGCTTGCGAGCCAGCGGGA No data
Right 1188881783 X:35499320-35499342 GCCAGCGGGAGTTCCCGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188881779 Original CRISPR TCCCGCTGGCTCGCAAGCGC CGG (reversed) Intergenic
No off target data available for this crispr