ID: 1188882701

View in Genome Browser
Species Human (GRCh38)
Location X:35509645-35509667
Sequence TCTCATCTACTGAAGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188882698_1188882701 29 Left 1188882698 X:35509593-35509615 CCAATACTTATTTCATAATTCTC No data
Right 1188882701 X:35509645-35509667 TCTCATCTACTGAAGGTGAAAGG No data
1188882699_1188882701 7 Left 1188882699 X:35509615-35509637 CCACATTTAAGAAAAAAATAATT No data
Right 1188882701 X:35509645-35509667 TCTCATCTACTGAAGGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188882701 Original CRISPR TCTCATCTACTGAAGGTGAA AGG Intergenic
No off target data available for this crispr