ID: 1188884623

View in Genome Browser
Species Human (GRCh38)
Location X:35534068-35534090
Sequence CGACATTACAAGAGGTAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188884623_1188884625 -1 Left 1188884623 X:35534068-35534090 CCAATCTACCTCTTGTAATGTCG No data
Right 1188884625 X:35534090-35534112 GTCATATCCTATAATTTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188884623 Original CRISPR CGACATTACAAGAGGTAGAT TGG (reversed) Intergenic
No off target data available for this crispr