ID: 1188890316

View in Genome Browser
Species Human (GRCh38)
Location X:35603904-35603926
Sequence GGTAATGTATTCACAGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188890316_1188890320 17 Left 1188890316 X:35603904-35603926 CCAACACCTGTGAATACATTACC No data
Right 1188890320 X:35603944-35603966 TTTCAGATGTAATTAAGTTAAGG No data
1188890316_1188890318 -9 Left 1188890316 X:35603904-35603926 CCAACACCTGTGAATACATTACC No data
Right 1188890318 X:35603918-35603940 TACATTACCTTAAATGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188890316 Original CRISPR GGTAATGTATTCACAGGTGT TGG (reversed) Intergenic
No off target data available for this crispr